View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10343_low_11 (Length: 205)

Name: NF10343_low_11
Description: NF10343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10343_low_11
NF10343_low_11
[»] chr4 (1 HSPs)
chr4 (8-184)||(30782542-30782718)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 8 - 184
Target Start/End: Complemental strand, 30782718 - 30782542
Alignment:
Q  8 agaagcaaaggagcaaacgcagaaaacatgacccatccattgtatcagttatccagattcctagtgatcgcgtaaacggctgacatataagtaaacacca 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  30782718 agaagcaaaggagcaaacgcagaaaacatgacccatccattgtatcagttatacagattcctagtgatcgcgtaaacggctgacatataagtaaacacca 30782619  T
Q  108 ttgaaagtgttgcaaaccatattgccaattggaaaggaagatttagatacataaacttttggattatttaatggaag 184  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30782618 ttgaaagtgttgcaaaccatatcgccaattggaaaggaagatttagatacataaacttttggattatttaatggaag 30782542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University