View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10341_low_16 (Length: 250)

Name: NF10341_low_16
Description: NF10341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10341_low_16
NF10341_low_16
[»] chr3 (2 HSPs)
chr3 (102-250)||(1036770-1036918)
chr3 (1-42)||(1036669-1036710)


Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 102 - 250
Target Start/End: Original strand, 1036770 - 1036918
Alignment:
Q  102 agtatgatacaatagcgtagtaaatcaaatcttataaacatttcaacttgatcatgattcaacactagagtttcacaagcttgttctacaatatcttttg 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  1036770 agtatgatacaatagcgtagtaaatcaaatcttataaacatttcaacttgatcatgattcaacactagagtttcacaagcttgttgtacaatatcttttg 1036869  T
Q  202 aaatgaaatatatcaataagaaaccatgtcaattgaaatagatcatgcc 250  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
T  1036870 aaatgaaatatatcaataagaaaccatgtcaattgaaatagatcatgcc 1036918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 1036669 - 1036710
Alignment:
Q  1 gcaatagatgatttatgcacaagataatgtaaactcactgta 42  Q
    ||||||||||| ||||||||||||||||||||| ||||||||    
T  1036669 gcaatagatgaattatgcacaagataatgtaaagtcactgta 1036710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University