View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1033_low_6 (Length: 201)

Name: NF1033_low_6
Description: NF1033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1033_low_6
NF1033_low_6
[»] chr7 (1 HSPs)
chr7 (85-200)||(40982908-40983023)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 85 - 200
Target Start/End: Original strand, 40982908 - 40983023
Alignment:
Q  85 cacagagaccagatatatcaggctttgacaagagtttggtactcttgggcatgccatgcagtttcttttgtttcggaatttgtttcttcattacagctgc 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40982908 cacagagaccagatatatcaggctttgacaagagtttggtactcttgggcatgccatgcagtttcttttgtttcggaatttgtttcttcattacagctgc 40983007  T
Q  185 tcctgtcatttcatcg 200  Q
    ||||||||||||||||    
T  40983008 tcctgtcatttcatcg 40983023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University