View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10336_low_22 (Length: 249)

Name: NF10336_low_22
Description: NF10336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10336_low_22
NF10336_low_22
[»] chr4 (2 HSPs)
chr4 (93-239)||(17319779-17319925)
chr4 (74-148)||(6437892-6437966)


Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 93 - 239
Target Start/End: Original strand, 17319779 - 17319925
Alignment:
Q  93 tttaagtagattgaatatatctccttgtatcttctatgagtggagttggaacccgaacgagtgcttaaaaagatgatttgggtgcggtgtttggctcacc 192  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17319779 tttaagtagattgaatatatctccctgtatcttctatgagtggagttggaacccgaacgagtgcttaaaaagatgatttgggtgcggtgtttggctcacc 17319878  T
Q  193 cagtccatggaatttagcttttgctagagggactaacttatcctttg 239  Q
    ||||||||||||||||||||||||||| | |||||||||||||||||    
T  17319879 cagtccatggaatttagcttttgctagggagactaacttatcctttg 17319925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 148
Target Start/End: Complemental strand, 6437966 - 6437892
Alignment:
Q  74 tgttatcttggcatttgtgtttaagtagattgaatatatctccttgtatcttctatgagtggagttggaacccga 148  Q
    |||| |||||||||| | ||||||| | |||||||||| |  ||||| | |||||||||||| ||||||||||||    
T  6437966 tgttgtcttggcattggagtttaagaaaattgaatatagcaacttgtttgttctatgagtggtgttggaacccga 6437892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University