View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10327_low_12 (Length: 394)

Name: NF10327_low_12
Description: NF10327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10327_low_12
NF10327_low_12
[»] chr6 (2 HSPs)
chr6 (18-157)||(20724120-20724259)
chr6 (278-377)||(20724026-20724125)
[»] chr5 (1 HSPs)
chr5 (143-209)||(42902412-42902478)


Alignment Details
Target: chr6 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 20724259 - 20724120
Alignment:
Q  18 gcagagagagttgggctttgggatccaaaccctaatgatgaaaacctataaacatactatcatagagcccatgatttttgcagtaaagaaatcaacatct 117  Q
    |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20724259 gcagagagagttggactttgggatccaaaccctagtgatgaaaacctataaacatactatcatagagcccatgatttttgcagtaaagaaatcaacatct 20724160  T
Q  118 tgaaggaactatagctttatgcgcaccatgtccaagatca 157  Q
    |||||||||| |||||||||||||||||||||||| ||||    
T  20724159 tgaaggaactctagctttatgcgcaccatgtccaacatca 20724120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 278 - 377
Target Start/End: Complemental strand, 20724125 - 20724026
Alignment:
Q  278 acatcagttttaatggtgctccaataagtatgaaagaaaaaggcaccaaactcaatggcccaagagcactctccttgttgaggacataaacatcattttt 377  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||    
T  20724125 acatcagttttaatggtgctccaataagtatgaaagaaaaaggcaccaaacccaatggcccaggagcactctccttgttgaggacataaacatcattttt 20724026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 143 - 209
Target Start/End: Original strand, 42902412 - 42902478
Alignment:
Q  143 ccatgtccaagatcactttcctcgatttatttgagtttgaggaaaatcatttcttatattatctgca 209  Q
    |||||||||||||||||||  ||||||||||||| |||| ||| |||||||||||| ||||||||||    
T  42902412 ccatgtccaagatcacttttgtcgatttatttgactttgcggacaatcatttcttacattatctgca 42902478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University