View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10326_low_1 (Length: 575)

Name: NF10326_low_1
Description: NF10326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10326_low_1
NF10326_low_1
[»] chr3 (2 HSPs)
chr3 (17-98)||(29134552-29134630)
chr3 (17-98)||(9460730-9460808)
[»] chr1 (1 HSPs)
chr1 (462-563)||(51386187-51386288)
[»] chr6 (1 HSPs)
chr6 (18-70)||(18332409-18332461)


Alignment Details
Target: chr3 (Bit Score: 46; Significance: 6e-17; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 29134552 - 29134630
Alignment:
Q  17 ctttggtgtatcccatgcaagcccaaataatctcccactcagcatgatttatgctgtttaccaaggc-atattaacgtgttac 98  Q
    ||||||||||||| ||||||||||||||||||||| ||||    |||||||||| |||||||||||| |||||||||||||||    
T  29134552 ctttggtgtatcctatgcaagcccaaataatctcctactc----tgatttatgcggtttaccaaggcaatattaacgtgttac 29134630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 17 - 98
Target Start/End: Original strand, 9460730 - 9460808
Alignment:
Q  17 ctttggtgtatcccatgcaagcccaaataatctcccactcagcatgatttatgctgtttaccaagg-catattaacgtgttac 98  Q
    ||||||||||||| |||||| |||||||||||||| ||||    |||||||||| ||||||||||| ||||||||||||||||    
T  9460730 ctttggtgtatcctatgcaatcccaaataatctcctactc----tgatttatgcggtttaccaaggccatattaacgtgttac 9460808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 6e-17; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 462 - 563
Target Start/End: Complemental strand, 51386288 - 51386187
Alignment:
Q  462 ttgcaaaagtaacgtttttcatggtcgtggttgtcgaattttgtttttctgggtatttaagtatggtggatttgaaatggctgtaaatactatgtgtctg 561  Q
    |||| ||||||||  |||||||||||||||||||||||||||| |||| |   ||||| ||| ||||||||||||||||| ||| | |||||||||| ||    
T  51386288 ttgctaaagtaacagttttcatggtcgtggttgtcgaattttgatttttttaatatttgagtttggtggatttgaaatggttgtgagtactatgtgtttg 51386189  T
Q  562 tg 563  Q
    ||    
T  51386188 tg 51386187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 18332461 - 18332409
Alignment:
Q  18 tttggtgtatcccatgcaagcccaaataatctcccactcagcatgatttatgc 70  Q
    |||||||||||||||||||||||||||||||  ||||||||||||||||||||    
T  18332461 tttggtgtatcccatgcaagcccaaataatcatccactcagcatgatttatgc 18332409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University