View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1031_low_14 (Length: 251)

Name: NF1031_low_14
Description: NF1031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1031_low_14
NF1031_low_14
[»] chr7 (1 HSPs)
chr7 (11-251)||(36883611-36883852)


Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 251
Target Start/End: Original strand, 36883611 - 36883852
Alignment:
Q  11 catccttagcta--gcacctaataaagtgcaacccccttcaggcttcatgccagaacatttcaatcggtgcaagttatgaaaagaatcagaacttaaaag 108  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  36883611 catccttagctattgcacctaataaagtgcaacccccttcaggcttcatgccagaacatttcaatcggtgcaagttatgaaaagaatcagaacttaaa-g 36883709  T
Q  109 ttaaaaccacccaaaagataataaaacttctggtaattaaactattgctcaatgccagttacaactttagccactagaatctttgcagtgacttactgga 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36883710 ttaaaaccacccaaaagataataaaacttctggtaattaaactattgctcaatgccagttacaactttagccactagaatctttgcagtgacttactgga 36883809  T
Q  209 aatttaacttgattgctcttcatgaatggtctcaaaatagcca 251  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  36883810 aatttaacttgattgctcttcatgaatggtctcaaaatagcca 36883852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University