View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10301_2D_high_11 (Length: 304)

Name: NF10301_2D_high_11
Description: NF10301_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10301_2D_high_11
NF10301_2D_high_11
[»] chr4 (1 HSPs)
chr4 (20-304)||(190809-191093)


Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 20 - 304
Target Start/End: Original strand, 190809 - 191093
Alignment:
Q  20 aaccggaagatgagcaaggttccgaaaggatacgttgccgtttatgttggaccggagtttagaaggtttgtgattccaataaggttcttgagcatggctg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  190809 aaccggaagatgagcaaggttccgaaaggatacgttgccgtttatgttggaccggagtttagaaggtttgtgattccaataaggttcttgagcatggctg 190908  T
Q  120 aggtgaaggagttgatggatgatgtagctgaggagtttggttgtgattatcacgctgatggtgctcttcatattccatgtgatgaagattattttcgcaa 219  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  190909 aggtgaaggagttgatggatgatatagctgaggagtttggttgtgattatcacgctgatggtgctcttcatattccatgtgatgaagattattttcgcaa 191008  T
Q  220 tgttttgattaattgttttgcaacacaaggcagggtatcttctaagaatcataagatcaaacttggtaataagaatgccttgatt 304  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  191009 tgttttgattaattgttttgcaacacaaggcagggtatcttctaagaatcataagatcaaacttggtaataagaatgccttgatt 191093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University