View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10301_1D_low_34 (Length: 205)

Name: NF10301_1D_low_34
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10301_1D_low_34
NF10301_1D_low_34
[»] chr4 (1 HSPs)
chr4 (94-205)||(53788091-53788203)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 94 - 205
Target Start/End: Original strand, 53788091 - 53788203
Alignment:
Q  94 attccatctatctaggacttcgttaaattcatttgcaaatgcttgttgggaaaatcaa-ctgttccattatttgagtatttgaataattttctttccaat 192  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||  ||||||||| || |||||    
T  53788091 attccatctatccaggacttcgttaaattcatttgcaaatgcttgttgggaaaatcaaccggttccattatttgagtattgcaataatttttttcccaat 53788190  T
Q  193 atttaatcacttc 205  Q
    |||||||||||||    
T  53788191 atttaatcacttc 53788203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University