View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10301_1D_low_31 (Length: 212)

Name: NF10301_1D_low_31
Description: NF10301_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10301_1D_low_31
NF10301_1D_low_31
[»] chr1 (2 HSPs)
chr1 (6-68)||(34731813-34731875)
chr1 (130-170)||(34731744-34731784)


Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 68
Target Start/End: Complemental strand, 34731875 - 34731813
Alignment:
Q  6 actagtaacttcactaatcagattttctgacaagtaataatctcttttaacttgtaaagtgag 68  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  34731875 actagtaacttcactaatcagattttctgacaaggaataatctcttttaacttgtaaagtgag 34731813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 130 - 170
Target Start/End: Complemental strand, 34731784 - 34731744
Alignment:
Q  130 tatcctcaaaacaagtttgagatctcttttatctgcgtttg 170  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  34731784 tatcctcaaaacaagtttgagatctcttttatctgcgtttg 34731744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University