View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10291_low_18 (Length: 273)

Name: NF10291_low_18
Description: NF10291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10291_low_18
NF10291_low_18
[»] chr7 (1 HSPs)
chr7 (24-234)||(46413212-46413426)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 24 - 234
Target Start/End: Original strand, 46413212 - 46413426
Alignment:
Q  24 cctattactttcacatttttacacaactcttactccactatcttcccttcctttcttgtccaaccctgtctctttgccaaagaatttactctgctggaaa 123  Q
    |||||||||||||||||||||||||||||||||||||||  | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46413212 cctattactttcacatttttacacaactcttactccactgccatcccttcctttcttgtccaaccctgtctctttgccaaagaatttactctgctggaaa 46413311  T
Q  124 ggcaagtaccacttgattacatcatctttttcgtctgacatggtcaactacttcaaatgcc----tccaaataatctgatcaggggaataactgaaaatt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    |||||||||||||||||||||||||||||||||||    
T  46413312 ggcaagtaccacttgattacatcatctttttcgtctgacatggtcaactacttcaaatggctgtgtccaaataatctgatcaggggaataactgaaaatt 46413411  T
Q  220 gattaggactttaaa 234  Q
    |||||||||||||||    
T  46413412 gattaggactttaaa 46413426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University