View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10283_low_7 (Length: 340)

Name: NF10283_low_7
Description: NF10283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10283_low_7
NF10283_low_7
[»] chr4 (1 HSPs)
chr4 (23-321)||(47475292-47475589)


Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 23 - 321
Target Start/End: Complemental strand, 47475589 - 47475292
Alignment:
Q  23 gtataaatcttctctctttgaacattggctaggtcatgatcatgcggcaatattcataatatctatgaaacttctaaaaactggctccaactacagtcga 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||    
T  47475589 gtataaatcttctctctttgaacattggctaggtcatgatcatgcggcaatattcataatatctattaa-cttctaaaaactggctcccactacagtcga 47475491  T
Q  123 agtcataacactaaactattgccacaaagtgaaaataccaccgggtcaacttggatttgaatctagtttggacttctttttgaaattcttttcatagata 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47475490 agtcataacactaaactattgccacaaagtgaaaataccaccgggtcaacttggatttgaatctagtttggacttctttttgaaattcttttcatagata 47475391  T
Q  223 ttgcccctttgtgatatcattccaaaggacatgatactaaaatctcatgcgatgtgttgattacttgcttccttattctttactcttttttgtattctc 321  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47475390 ttgcccctttgtgatatcattccaaaggacatgatactaaaatctcatgcgatgtgttgattacttgcttccttattctttactcttttttgtattctc 47475292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University