View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10283_low_11 (Length: 257)

Name: NF10283_low_11
Description: NF10283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10283_low_11
NF10283_low_11
[»] chr7 (2 HSPs)
chr7 (39-249)||(25690409-25690619)
chr7 (38-101)||(25689524-25689587)
[»] chr4 (1 HSPs)
chr4 (44-84)||(5588373-5588413)


Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 39 - 249
Target Start/End: Original strand, 25690409 - 25690619
Alignment:
Q  39 gaaccgcatattcataggctttgaatagacatgagaaattttagaataattcggattgtatttgtcgaaatttggtttggattataattgtcgagcaaat 138  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||    
T  25690409 gaaccgcatattcataggctttgaatagacatgagaaattttaaaataattcggattgtatttgtcgaaatttggttcggattataattgttgagcaaat 25690508  T
Q  139 gatatttttgaaagnnnnnnntagggtgcatgagtaacacaggggggaaaaaacaatagccttnnnnnnntgttgttctttctctttcagtcgactctca 238  Q
    ||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||       ||| ||||||||||||||| ||||||||||    
T  25690509 gatatttttgaaagaaaaaaatagggtgcatgagtaacacaggggggaaaaaacaatagccttaaaaaaatgtcgttctttctctttcactcgactctca 25690608  T
Q  239 tttttcttctc 249  Q
    |||||||||||    
T  25690609 tttttcttctc 25690619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 101
Target Start/End: Complemental strand, 25689587 - 25689524
Alignment:
Q  38 cgaaccgcatattcataggctttgaatagacatgagaaattttagaataattcggattgtattt 101  Q
    ||||| ||||||| | | |||||||||||||||||| |||||||||| | ||||||||||||||    
T  25689587 cgaactgcatatttacaagctttgaatagacatgagcaattttagaacagttcggattgtattt 25689524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 44 - 84
Target Start/End: Complemental strand, 5588413 - 5588373
Alignment:
Q  44 gcatattcataggctttgaatagacatgagaaattttagaa 84  Q
    |||||||||||||||||||||| | ||||| ||||||||||    
T  5588413 gcatattcataggctttgaataaatatgagcaattttagaa 5588373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University