View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10279_low_11 (Length: 227)

Name: NF10279_low_11
Description: NF10279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10279_low_11
NF10279_low_11
[»] chr7 (1 HSPs)
chr7 (47-224)||(48655835-48656013)


Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 47 - 224
Target Start/End: Complemental strand, 48656013 - 48655835
Alignment:
Q  47 ccgttatcccccatctaccacaccctccaccctctctcgccactgtcgcccatcgaccacaccctcgatcaccacaacccttgcccttcgccctaccata 146  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48656013 ccgtcatcccccatctaccacaccctccaccctctctcgccactgtcgcccatcgaccacaccctcgatcaccacaacccttgcccttcgccctaccata 48655914  T
Q  147 tcttcatatcgcaccaacagatccacaccc-nnnnnnncccttatgttctccttccattgccaccaccacctatgcttc 224  Q
    |||||||||| ||||| |||||||||||||         ||||||||||||||||||||||| ||||||||||||||||    
T  48655913 tcttcatatcacaccagcagatccacacccaaaaaaaaaccttatgttctccttccattgccgccaccacctatgcttc 48655835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University