View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10277_low_9 (Length: 240)

Name: NF10277_low_9
Description: NF10277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10277_low_9
NF10277_low_9
[»] chr8 (1 HSPs)
chr8 (1-222)||(7353846-7354062)
[»] chr3 (1 HSPs)
chr3 (161-222)||(38549107-38549168)


Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 7353846 - 7354062
Alignment:
Q  1 ttaagggagaacaacatggagtgctgctacagtacttgtggcgatttcgctgctggattctctcgaagagtggagtgcttatggaggtttttagattcaa 100  Q
    ||||| ||||||||||||||||| |||| ||||| |||||||||||||||  |||||||||| ||||||||||||| |||||||||||||||||||||||    
T  7353846 ttaagtgagaacaacatggagtgttgctgcagtagttgtggcgatttcgccactggattctcacgaagagtggagtacttatggaggtttttagattcaa 7353945  T
Q  101 ccagttcgacatttaaaaaccgtgacaacgatgaaaggagaatgatgaaaggtgaggctgcaaaagcatcgacaaaccaacgtgaaacgattgaaaggaa 200  Q
    |||||||| |||| |||||||||||||  |||||||||| ||||||| |||| |||||||||||||||| ||||||||| ||||||| |     || |||    
T  7353946 ccagttcggcattcaaaaaccgtgacagtgatgaaaggaaaatgatggaaggcgaggctgcaaaagcattgacaaaccagcgtgaaatg-----aacgaa 7354040  T
Q  201 aggagagaaaaatggtgtgaaa 222  Q
    ||||||||||||||||||||||    
T  7354041 aggagagaaaaatggtgtgaaa 7354062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 161 - 222
Target Start/End: Complemental strand, 38549168 - 38549107
Alignment:
Q  161 caaaagcatcgacaaaccaacgtgaaacgattgaaaggaaaggagagaaaaatggtgtgaaa 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38549168 caaaagcatcgacaaaccaacgtgaaacgattgaaaggaaaggagagaaaaatggtgtgaaa 38549107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University