View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10274_low_19 (Length: 281)

Name: NF10274_low_19
Description: NF10274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10274_low_19
NF10274_low_19
[»] chr3 (1 HSPs)
chr3 (17-270)||(26257665-26257918)


Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 270
Target Start/End: Complemental strand, 26257918 - 26257665
Alignment:
Q  17 agcaaatgcaaaaggctatacacaagcaaacacgcaagcatatgctcaaggctatgcacgagcatacgcgcaaggatgtgcacaagcatatgcagaagga 116  Q
    |||||||||||||||||||  |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26257918 agcaaatgcaaaaggctatgaacaagcaaacgcgcaagcatatgctcaaggctatgcacgagcatacgcgcaaggatgtgcacaagcatatgcagaagga 26257819  T
Q  117 tacgcgcaaggtttcatttgcagccaattcaaacatgcacttactttggacaaaaagtaactttctttttggcataaaatctgctactgacattggaatt 216  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||    
T  26257818 tacgcgcaaggtttcatttgcagccaattcaaacatgcccttactttggacaaaaagtaactttctttttggcaaaaaatcggctactgacattggaatt 26257719  T
Q  217 taccttctgttttctacttcaaaataaaagctatcatatgctttagtctttctt 270  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||    
T  26257718 taccttctgttttctacttcaaaataaaagctattatatgctttagtctttctt 26257665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University