View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10269_low_35 (Length: 206)

Name: NF10269_low_35
Description: NF10269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10269_low_35
NF10269_low_35
[»] chr8 (1 HSPs)
chr8 (14-69)||(9516040-9516095)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 14 - 69
Target Start/End: Complemental strand, 9516095 - 9516040
Alignment:
Q  14 aagaatgatgggtgtgaggagaataaggattatgaatttgtaagataacatggtag 69  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  9516095 aagaatgatgggtgtgaggggaataaggattatgaatttgtaagataacatggtag 9516040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University