View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10268_low_17 (Length: 241)

Name: NF10268_low_17
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10268_low_17
NF10268_low_17
[»] chr3 (1 HSPs)
chr3 (108-223)||(33328598-33328713)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 108 - 223
Target Start/End: Original strand, 33328598 - 33328713
Alignment:
Q  108 gatgatccttactctcttccacggagtttgttttgaatattagtgatgtgatggacaatattatcatcagttatcatgatcaagcagttaccatcacctc 207  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  33328598 gatgatccttactctcttccgcggaggttgttttgaatattagtgatgtgatggacaatattatcatcagttatcatgatcaagcaattaccatcacctc 33328697  T
Q  208 aaaggtatgcatctct 223  Q
    ||||||||||||||||    
T  33328698 aaaggtatgcatctct 33328713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University