View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10265_low_34 (Length: 263)

Name: NF10265_low_34
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10265_low_34
NF10265_low_34
[»] chr2 (2 HSPs)
chr2 (146-260)||(16119303-16119417)
chr2 (146-260)||(16339672-16339786)


Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 146 - 260
Target Start/End: Complemental strand, 16119417 - 16119303
Alignment:
Q  146 cttctgatatattgtagaaaaccatgtcagataaattgcaatgacattgtgttaacttgaaacatttcattggacaggtctagtgctgcagaagctccta 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||  |||||||| ||||||||    
T  16119417 cttctgatatattgtagaaaaccatgtcagataaattgcaatgacattgtgttaacttaaaacatttcattggacaggtcttttgctgcagcagctccta 16119318  T
Q  246 gaagtgtcaaaacgt 260  Q
    |||||||||||||||    
T  16119317 gaagtgtcaaaacgt 16119303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 146 - 260
Target Start/End: Original strand, 16339672 - 16339786
Alignment:
Q  146 cttctgatatattgtagaaaaccatgtcagataaattgcaatgacattgtgttaacttgaaacatttcattggacaggtctagtgctgcagaagctccta 245  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||  |||||||| ||||||||    
T  16339672 cttctgatatattgtagaaaaccatgtcagataaattgcaatgacattgtgttaacttaaaacatttcattggacaggtcttttgctgcagcagctccta 16339771  T
Q  246 gaagtgtcaaaacgt 260  Q
    |||||||||||||||    
T  16339772 gaagtgtcaaaacgt 16339786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University