View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10265_low_26 (Length: 299)

Name: NF10265_low_26
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10265_low_26
NF10265_low_26
[»] chr6 (1 HSPs)
chr6 (1-281)||(3225313-3225593)


Alignment Details
Target: chr6 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 3225593 - 3225313
Alignment:
Q  1 caagaagggaaatgaggcaaaaaggtaaaaaacatgatggaccatgtgaagcaaccaacccaattgatagttgttggaggtgcaaagccgattgggctgc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3225593 caagaagggaaatgaggcaaaaaggtaaaaaacatgatggaccatgtgaagcaaccaacccaattgatagttgttggaggtgcaaagccgattgggctgc 3225494  T
Q  101 gaatcgatttcaattagccaagtgtagtaagggctttggaagaaaggcaactggtgggcttggaggtccaatctatgtggtcactgatgagtctgataat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3225493 gaatcgatttcaattagccaagtgtagtaagggctttggaagaaagacaactggtgggcttggaggtccaatctatgtggtcactgatgagtctgataat 3225394  T
Q  201 gacatggtaaaccctaaacctggaacccttagatttggtgttgtccaaaagggaccattatggatcacttttgcacgtagc 281  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  3225393 gacatggtaaaccctaaacctggaacccttagatttggtgctgtccaaaagggaccattatggatcacttttgcacgtagc 3225313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University