View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10262_low_20 (Length: 206)

Name: NF10262_low_20
Description: NF10262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10262_low_20
NF10262_low_20
[»] chr4 (2 HSPs)
chr4 (14-156)||(37792252-37792394)
chr4 (14-84)||(37801944-37802014)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 14 - 156
Target Start/End: Original strand, 37792252 - 37792394
Alignment:
Q  14 cagagatttgacccaatggaagcttggttacaatatcagacttctcatggtaacttattcggtatgctcatacaactttcccaacactcccttagtccaa 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||    
T  37792252 cagagatttgacccaatggaagcttggttacaatatcagacttctcatggtagcttattcggtatgctcatacaactttaccaacactcccttagtccaa 37792351  T
Q  114 aattgaatgatcaagttgatagtatcacacatattaatgtaca 156  Q
    |||||||||||||| ||||| ||||||||||||||||||||||    
T  37792352 aattgaatgatcaatttgattgtatcacacatattaatgtaca 37792394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 14 - 84
Target Start/End: Original strand, 37801944 - 37802014
Alignment:
Q  14 cagagatttgacccaatggaagcttggttacaatatcagacttctcatggtaacttattcggtatgctcat 84  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  37801944 cagagatttgacccaatggaagcttggttacaatatcagacttctcatggtagcttattcggtatgctcat 37802014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University