View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10261A_low_497 (Length: 201)

Name: NF10261A_low_497
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10261A_low_497
NF10261A_low_497
[»] chr2 (1 HSPs)
chr2 (37-181)||(45626054-45626198)


Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 37 - 181
Target Start/End: Complemental strand, 45626198 - 45626054
Alignment:
Q  37 aatattaacatacatgactatactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagttgg 136  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  45626198 aatattaacatacatgactatactattcgaaagctatatttatattgatttgatttcaggtccaaattcccttgagaaggggaacagtagagggagttgc 45626099  T
Q  137 agtgtcttcaaatttaaaagtgtcgaggagatcagagcaggatgc 181  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  45626098 agtgtcttcaaatttaaaagtgtcgaggagatcagagcaggatgc 45626054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University