View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10261A_low_294 (Length: 244)

Name: NF10261A_low_294
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10261A_low_294
NF10261A_low_294
[»] chr2 (1 HSPs)
chr2 (10-240)||(1329433-1329663)


Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 240
Target Start/End: Original strand, 1329433 - 1329663
Alignment:
Q  10 aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagcagttagaggttatggaagagtttatcaaagataagaaca 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
T  1329433 aagaatattggaatttgtcgctcttctgagtaccctgagatagataaggtcacaccaaagaagttagaggttatggaagagtttatcaaagataagaaca 1329532  T
Q  110 tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1329533 tgctagcacaaagcaataaagctgatgttcaagaagagaacaattcggatgaagaagccaaggaacccgaacccgaacctgaaccggaagaggatatgaa 1329632  T
Q  210 tgaagtcaaggcccttccaccaccagaggaa 240  Q
    || ||||||||||||||||||||||||||||    
T  1329633 tgcagtcaaggcccttccaccaccagaggaa 1329663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University