View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10261A_low_265 (Length: 248)

Name: NF10261A_low_265
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10261A_low_265
NF10261A_low_265
[»] chr7 (2 HSPs)
chr7 (9-138)||(37372175-37372304)
chr7 (157-248)||(37372290-37372382)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 9 - 138
Target Start/End: Original strand, 37372175 - 37372304
Alignment:
Q  9 atgagatggacatcactcaagaccgcaccaaaataatgttatgtacatacaaaacctataaattttgcattaaggaaataaatgagatggatggtagtca 108  Q
    |||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||    
T  37372175 atgacatggacctcactcaagaccgcaccaaaataatgttatgtacatacaagacctataaattttgcattaaggaaataaatgagatggatggttgtca 37372274  T
Q  109 aattaacagtggcaagtggagatttaggaa 138  Q
    |||||  |||||||||||||||||||||||    
T  37372275 aattactagtggcaagtggagatttaggaa 37372304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 157 - 248
Target Start/End: Original strand, 37372290 - 37372382
Alignment:
Q  157 gtggagatttaggaaaactacaagagaaaatattataaaa-ttttagagattgatgagttcgagaatgatgtgatatatgacataatattata 248  Q
    ||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  37372290 gtggagatttaggaaaactacaagagaaattattataaaagttttagagattgatgagttcgagagtgatgtgatatatgacataatattata 37372382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University