View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10261A_low_228 (Length: 252)

Name: NF10261A_low_228
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10261A_low_228
NF10261A_low_228
[»] chr4 (1 HSPs)
chr4 (1-251)||(4705715-4705965)


Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 4705715 - 4705965
Alignment:
Q  1 tcattgtctttcaaaattcagagtttctaatccattacatttaattccaaatcttgcagttgccagagaaaatcttcaggagcttggacaattcaacaaa 100  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4705715 tcattgtctttcgaaattcagagtttctaatccattacatttaattccaaatcttgcagttgccagagaaaatcttcaggagcttggacaattcaacaaa 4705814  T
Q  101 aatgttgagatttacaataccgtttccaatgcttgcatatcctttctaccttgtaagttgtaatacctaactattttaccagaatttgaacatgatttgc 200  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  4705815 aatgttgagatttacaataccttttccaatgcttgcatatcctttctaccttgtaagttgtaatacctaactattttaccagaatttgaacatgttttgc 4705914  T
Q  201 tattagttatggtgtatgaattgatctatgaggcactaacaccaaactcga 251  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  4705915 tattagttatggtgtatgaattgatctatgaggcactcacaccaaactcga 4705965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University