View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10261A_low_197 (Length: 264)

Name: NF10261A_low_197
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10261A_low_197
NF10261A_low_197
[»] chr1 (1 HSPs)
chr1 (132-245)||(32258913-32259026)
[»] chr3 (1 HSPs)
chr3 (13-80)||(34899908-34899975)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 132 - 245
Target Start/End: Complemental strand, 32259026 - 32258913
Alignment:
Q  132 tatcgtgaagttggcatgcggctgaaggaataccctgaagaagatgttagaaaagcaagaaaattgatttcaagcttcataagagccgctgaagaagtag 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  32259026 tatcgtgaagttggcatgcggctgaaggaataccctgaagaagatgttagaaaagcaaggaaattgatttcaagcttcataagagccgctgaagaagtag 32258927  T
Q  232 aagaggtaatttct 245  Q
    ||||||||||||||    
T  32258926 aagaggtaatttct 32258913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 34899975 - 34899908
Alignment:
Q  13 atctcaacttgaaagtttaaactaccaaactttacatatgtgcatataaaaacatctctatttagttc 80  Q
    ||||||||||||||||| ||||||||||||||||| ||| |||||||||| |||||||| ||||||||    
T  34899975 atctcaacttgaaagttgaaactaccaaactttacctatatgcatataaacacatctctctttagttc 34899908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University