View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10260_low_62 (Length: 250)

Name: NF10260_low_62
Description: NF10260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10260_low_62
NF10260_low_62
[»] chr2 (1 HSPs)
chr2 (4-245)||(13202629-13202871)
[»] chr4 (1 HSPs)
chr4 (163-231)||(50326029-50326097)


Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 4 - 245
Target Start/End: Complemental strand, 13202871 - 13202629
Alignment:
Q  4 ctcatgttttgtgtttattctaaattacaaaatgctttcagttttgcttcgat-ataactattgtaagatatgatgaaatagacaatattacacagtttc 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  13202871 ctcatgttttgtgtttattctaaattacaaaatgctttcagttttgcttcgatgataactattgtaagatatgatgaaatagacaatattacacagtttc 13202772  T
Q  103 aaaggtaaaatttccttttgtagacacatgagccttatagattcttttgcattgtaggagtggctgcaggaatatactcgggcctaacatatgggctgaa 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||    
T  13202771 aaaggtaaaatttccttttgtagacacatgagccttatagattcttttgcattgcaggagtggctgcaggaatatactccggcctaacatatgggctgaa 13202672  T
Q  203 ggaagctcgaggaactcatgactgggtaaatgcctttgcttct 245  Q
    ||||||||||||| |||||||||||||||||||||||| ||||    
T  13202671 ggaagctcgaggagctcatgactgggtaaatgcctttgtttct 13202629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 163 - 231
Target Start/End: Original strand, 50326029 - 50326097
Alignment:
Q  163 tggctgcaggaatatactcgggcctaacatatgggctgaaggaagctcgaggaactcatgactgggtaa 231  Q
    ||||||||||| |||| || || || ||||||||| ||||||||||||| || ||||||||||||||||    
T  50326029 tggctgcaggactatattcaggactcacatatgggatgaaggaagctcgtggtactcatgactgggtaa 50326097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University