View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1026-Insertion-19 (Length: 85)

Name: NF1026-Insertion-19
Description: NF1026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1026-Insertion-19
NF1026-Insertion-19
[»] chr6 (2 HSPs)
chr6 (8-85)||(20812515-20812592)
chr6 (9-85)||(20814424-20814500)
[»] chr2 (1 HSPs)
chr2 (8-85)||(21458708-21458785)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 2e-27; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 20812592 - 20812515
Alignment:
Q  8 tgatagagttttggagtattctgcaacggcaggacaggttcagatattttacaggatatcaaattgcagcagcatttt 85  Q
    |||||||||| |||||||||||||| ||  ||||||||||||||||||||||||||||||||||||||||||||||||    
T  20812592 tgatagagttctggagtattctgcagcgagaggacaggttcagatattttacaggatatcaaattgcagcagcatttt 20812515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 53; E-Value: 5e-22
Query Start/End: Original strand, 9 - 85
Target Start/End: Complemental strand, 20814500 - 20814424
Alignment:
Q  9 gatagagttttggagtattctgcaacggcaggacaggttcagatattttacaggatatcaaattgcagcagcatttt 85  Q
    |||||||||| ||||||||||||| || |||||||| ||||||||||||||||||||||||| |||| |||||||||    
T  20814500 gatagagtttcggagtattctgcagcgacaggacagattcagatattttacaggatatcaaaatgcatcagcatttt 20814424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 54; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 1e-22
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 21458785 - 21458708
Alignment:
Q  8 tgatagagttttggagtattctgcaacggcaggacaggttcagatattttacaggatatcaaattgcagcagcatttt 85  Q
    |||||| |||||||||||||||| | || |||||||| |||||||||||||||||||||||||||||| |||||||||    
T  21458785 tgatagcgttttggagtattctggagcgacaggacagattcagatattttacaggatatcaaattgcatcagcatttt 21458708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University