View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10259_high_19 (Length: 208)

Name: NF10259_high_19
Description: NF10259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10259_high_19
NF10259_high_19
[»] chr5 (3 HSPs)
chr5 (1-208)||(17976693-17976900)
chr5 (1-69)||(17914398-17914466)
chr5 (1-66)||(35273353-35273418)


Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 17976693 - 17976900
Alignment:
Q  1 aagtggcgggaagattaatttcgcgcattccactggcacggagaatgcaccgccattgttagcatcagatggggggagaggcttggaataggaaacaacc 100  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||    
T  17976693 aagtggcgggaagattaatttcgcgcattccactggcacagagaatgcaccgccattgttagcatcagatggggtgagagtcttggaataggaaacaacc 17976792  T
Q  101 tttttgtcatcatctttgtcttcacgaacctcaagagaccgaggttcgtgaacacctttgttagtgaccggannnnnnnnnagtttgacgaagactttat 200  Q
    ||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||| |||         |||||||||||||||| ||    
T  17976793 tttttgtcatcatctttgtcttcacgaacctcaagagagtgaggttcgtgaacacctttgttagtgacaggagtgaggagtagtttgacgaagacttcat 17976892  T
Q  201 cgggacaa 208  Q
    ||| ||||    
T  17976893 cggtacaa 17976900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 17914466 - 17914398
Alignment:
Q  1 aagtggcgggaagattaatttcgcgcattccactggcacggagaatgcaccgccattgttagcatcaga 69  Q
    ||||||||||||||||||||| ||||||||    ||||| |||||||||||||| || |||||||||||    
T  17914466 aagtggcgggaagattaattttgcgcattcgctaggcactgagaatgcaccgccgttattagcatcaga 17914398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 35273418 - 35273353
Alignment:
Q  1 aagtggcgggaagattaatttcgcgcattccactggcacggagaatgcaccgccattgttagcatc 66  Q
    |||||||||||| || ||||||||||||||    || |||||||||||||||||||| ||||||||    
T  35273418 aagtggcgggaatatcaatttcgcgcattcagaaggtacggagaatgcaccgccattattagcatc 35273353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University