View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10248_low_6 (Length: 218)

Name: NF10248_low_6
Description: NF10248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10248_low_6
NF10248_low_6
[»] chr8 (1 HSPs)
chr8 (19-83)||(4609078-4609142)


Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 83
Target Start/End: Original strand, 4609078 - 4609142
Alignment:
Q  19 acattgttcagtggaagtagagagaaatgggctgctgtaaagattcaaactttcttcagaggcta 83  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4609078 acattgttcagtggaagtagagagaaatgggctgctgtaaagattcaaactttcttcagaggcta 4609142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University