View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10233A_low_381 (Length: 204)

Name: NF10233A_low_381
Description: NF10233A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10233A_low_381
NF10233A_low_381
[»] chr1 (1 HSPs)
chr1 (14-183)||(32096357-32096526)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 183
Target Start/End: Complemental strand, 32096526 - 32096357
Alignment:
Q  14 acagagaagaaaaaggtgaggattgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattg 113  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32096526 acagataagaaaaaggtgaggattgtggaagagtgtggagccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattg 32096427  T
Q  114 agagtgatgctttgttggagattgagtgtttgcatagagaaggattgttgcttgatgttatggtaatgtt 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  32096426 agagtgatgctttgttggagattgagtgtttgcatagagaaggattgttgcttgacgttatggtaatgtt 32096357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University