View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10220_low_10 (Length: 211)

Name: NF10220_low_10
Description: NF10220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10220_low_10
NF10220_low_10
[»] chr2 (1 HSPs)
chr2 (15-193)||(8024061-8024239)


Alignment Details
Target: chr2 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 8024061 - 8024239
Alignment:
Q  15 atgaagatagcacaaaagtagtcaagtaagnnnnnnnntgcaagaatatgacgcattgattgttatagctagcaaatggatgattgtttgggtgaaatca 114  Q
    ||||||||| ||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8024061 atgaagataacacaaaagtagtcaagtaagaaaaaaaatgcaagaatatgacgcattgattgttatagctagcaaatggatgattgtttgggtgaaatca 8024160  T
Q  115 tgtatggataactttgaagattagttcatagttcaagtaagaaacaactgcataaatatgacgcattgattgttacagt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8024161 tgtatggataactttgaagattagttcatagttcaagtaagaaacaactgcataaatatgacgcattgattgttacagt 8024239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University