View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10213_low_26 (Length: 241)

Name: NF10213_low_26
Description: NF10213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10213_low_26
NF10213_low_26
[»] chr7 (1 HSPs)
chr7 (39-226)||(37664846-37665033)


Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 39 - 226
Target Start/End: Original strand, 37664846 - 37665033
Alignment:
Q  39 tgagattgaaatgtgaaatgcaatacagaaacagaccgtttgtttttaatagaagtaattcacggtgctaatcttcttcttcgtcggaatggtaaaggca 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  37664846 tgagattgaaatgtgaaatgcaatacagaaacagaccgtttgtttttaatagaagtaattcacggtgctaatcttcttcttcgtcggaatggtgaaggca 37664945  T
Q  139 tgtttgatttggcgggaaaatgaaaactggattggtagttaatttcgatgattgattcttctcaacgttgttaggtatatggtctgtg 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37664946 tgtttgatttggcgggaaaatgaaaactggattggtagttaatttcgatgattgattcttctcaacgttgttaggtatatggtctgtg 37665033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University