View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10211_low_62 (Length: 226)

Name: NF10211_low_62
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10211_low_62
NF10211_low_62
[»] chr1 (1 HSPs)
chr1 (8-224)||(36525933-36526149)


Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 224
Target Start/End: Original strand, 36525933 - 36526149
Alignment:
Q  8 atttatattatttagggactaattatatttacataatttagacttcaaattgaagtgtaagtgatagtttacggactacatcgatggtttattcttcgtt 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||    
T  36525933 atttatattatttagggactaattatatttacataatttagacttcaaattgaagtgtaggtgatagtttacagactacatcgatggtttattcttcgtt 36526032  T
Q  108 ttccccacgatgctattgttactatctatattactaccgtatagagagagcaatataaaaatactggataacataaaacagatagccccccaaagcggca 207  Q
    |||||  | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||    
T  36526033 ttccctgcaatgctattgttactatctatattactatcgtatagagagagcaatataaaaatactggaaaacataaaacagatagccccccaaagtggca 36526132  T
Q  208 tatgcattgcgacgtta 224  Q
    |||||||||||||||||    
T  36526133 tatgcattgcgacgtta 36526149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University