View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10211_low_46 (Length: 250)

Name: NF10211_low_46
Description: NF10211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10211_low_46
NF10211_low_46
[»] chr7 (1 HSPs)
chr7 (61-240)||(26895158-26895333)


Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 61 - 240
Target Start/End: Original strand, 26895158 - 26895333
Alignment:
Q  61 tttgtatgacgtttgcttaccatacagctaccaatcataaaaatatggctttaatctacattgtcagtgctatgcaggaagtatctgtttagtggaaagt 160  Q
    ||||||| ||||||||||| |||||| ||||||||||||    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  26895158 tttgtataacgtttgcttatcatacatctaccaatcata----tatggctttaatctacattgtcagtgctatgcaggaagtatcagtttagtggaaagt 26895253  T
Q  161 tgctgatatattgaactaagatacagatagtgtattaagtaaggcttggtagcactccttcctaatccatataacctttg 240  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  26895254 tgctgatatattgaactaagatacagatggtgtattaagtaaggcttggtagcactccttcctaatccatataacttttg 26895333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University