View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1020_low_7 (Length: 270)

Name: NF1020_low_7
Description: NF1020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1020_low_7
NF1020_low_7
[»] chr4 (1 HSPs)
chr4 (34-195)||(40126865-40127027)


Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 34 - 195
Target Start/End: Original strand, 40126865 - 40127027
Alignment:
Q  34 tctgcagagattagtcatcgaaaatattggtggattacttcgcaccaataacatggttaccattcttcttcnnnnnnnn-aatacgataaccttatcatt 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||          |||| |||||||||||||||    
T  40126865 tctgcagagattagtcatcgaaaatattggtggattacttcgcaccaataacatggttaccgtttttcttttttttttttaataagataaccttatcatt 40126964  T
Q  133 ttgtttaacagtctattcatgtttatggccacacattaattgaattgtgattagaaaacagag 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40126965 ttgtttaacagtctattcatgtttatggccacacattaattgaattgtgattagaaaacagag 40127027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University