View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10208_low_11 (Length: 205)

Name: NF10208_low_11
Description: NF10208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10208_low_11
NF10208_low_11
[»] chr8 (1 HSPs)
chr8 (69-185)||(10195753-10195869)
[»] chr7 (1 HSPs)
chr7 (91-171)||(48411115-48411195)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 69 - 185
Target Start/End: Original strand, 10195753 - 10195869
Alignment:
Q  69 ctaacaaatagtgattttacaatgcagaggatactacagatgcacacatagacatgcacaaggttgtctagctactaagcaagtgcaaaaatcagatgaa 168  Q
    |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10195753 ctaacagatagtgattttgcaatgcagaggatactacagatgcacacatagacatgcacaaggttgtctagctactaagcaagtgcaaaaatcagatgaa 10195852  T
Q  169 gatgagatgatatgtga 185  Q
    ||||| |||||||||||    
T  10195853 gatgaaatgatatgtga 10195869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 91 - 171
Target Start/End: Complemental strand, 48411195 - 48411115
Alignment:
Q  91 tgcagaggatactacagatgcacacatagacatgcacaaggttgtctagctactaagcaagtgcaaaaatcagatgaagat 171  Q
    |||||||| || |||||||||||||||||| ||| |||||| || ||||| || |||||||| ||||  ||||||||||||    
T  48411195 tgcagagggtattacagatgcacacatagaaatggacaaggatgcctagcaacaaagcaagttcaaaggtcagatgaagat 48411115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University