View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10207_low_53 (Length: 226)

Name: NF10207_low_53
Description: NF10207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10207_low_53
NF10207_low_53
[»] chr6 (2 HSPs)
chr6 (134-206)||(14171974-14172046)
chr6 (15-90)||(14171855-14171930)


Alignment Details
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 134 - 206
Target Start/End: Original strand, 14171974 - 14172046
Alignment:
Q  134 atgacgaaagcgggagtaagacataaaagtgtttaggctctgaagatctttcagactctaaaggtcaacatct 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14171974 atgacgaaagcgggagtaagacataaaagtgtttaggctctgaagatctttcagactctaaaggtcaacatct 14172046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 15 - 90
Target Start/End: Original strand, 14171855 - 14171930
Alignment:
Q  15 cagagacgtcagagtgaaattaaagttgaactagtcaaaaggcaagaggaattgcttctgaatatttcgtattatg 90  Q
    |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14171855 cagaaacgtcagagtgaaattcaagttgaactagtcaaaaggcaagaggaattgcttctgaatatttcgtattatg 14171930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University