View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10201A_low_92 (Length: 312)

Name: NF10201A_low_92
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10201A_low_92
NF10201A_low_92
[»] chr1 (2 HSPs)
chr1 (69-126)||(51376229-51376286)
chr1 (144-189)||(51821029-51821074)


Alignment Details
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 69 - 126
Target Start/End: Complemental strand, 51376286 - 51376229
Alignment:
Q  69 tcataggtaataggtattgaaggaacacttatgtaaatgactaaaagaggattggaaa 126  Q
    |||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||    
T  51376286 tcataggtaataggtattgaaggaacacttctgtaaatgaataaaagaggattggaaa 51376229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 189
Target Start/End: Original strand, 51821029 - 51821074
Alignment:
Q  144 cttttaggtaagcctttattccatcatgaaagaaatttgactcttg 189  Q
    |||||||||||| |||||||  ||||||||||||| ||||||||||    
T  51821029 cttttaggtaagtctttattatatcatgaaagaaaattgactcttg 51821074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University