View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10201A_low_175 (Length: 252)

Name: NF10201A_low_175
Description: NF10201A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10201A_low_175
NF10201A_low_175
[»] chr5 (1 HSPs)
chr5 (21-252)||(19190388-19190619)


Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 21 - 252
Target Start/End: Complemental strand, 19190619 - 19190388
Alignment:
Q  21 atcacgaccatccctaccataccctccaaaactttgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19190619 atcacgaccatccctaccataccctccaaaactttgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg 19190520  T
Q  121 ccatatccaccaatactcgtacgccctccatcaccatatccacccccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccag 220  Q
    ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19190519 ccatatccaccaatactcgaacgccctccatcaccatatccaccaccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccag 19190420  T
Q  221 aacggtcatcggaaccataaccaccaccaaaa 252  Q
    ||||||||||||||||||||||||||||||||    
T  19190419 aacggtcatcggaaccataaccaccaccaaaa 19190388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University