View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10197_high_17 (Length: 300)

Name: NF10197_high_17
Description: NF10197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10197_high_17
NF10197_high_17
[»] chr6 (1 HSPs)
chr6 (130-245)||(9410384-9410499)


Alignment Details
Target: chr6 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 130 - 245
Target Start/End: Original strand, 9410384 - 9410499
Alignment:
Q  130 gtattacatatatagctgcaactattgtatactgcaacatcccaaactacattccaaacatgaattgaatggtttctcctcacttcaaaatggcaatgtt 229  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9410384 gtataacatatatagctgcaactattgtatactgcaacatcccaaactacattccaaacatgaattgaatggtttctcctcacttcaaaatggcaatgtt 9410483  T
Q  230 ttaagaatctaaccgt 245  Q
    ||||||||||||||||    
T  9410484 ttaagaatctaaccgt 9410499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University