View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10182_low_24 (Length: 262)

Name: NF10182_low_24
Description: NF10182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10182_low_24
NF10182_low_24
[»] chr7 (2 HSPs)
chr7 (115-173)||(441935-441993)
chr7 (14-66)||(441834-441886)


Alignment Details
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 115 - 173
Target Start/End: Original strand, 441935 - 441993
Alignment:
Q  115 aggggttaagcaaaattatatagaaagcagagtacaatttatataaattaaactcttct 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  441935 aggggttaagcaaaattatatagaaagcagagtacaatttatataaattaaactcttct 441993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 14 - 66
Target Start/End: Original strand, 441834 - 441886
Alignment:
Q  14 gttgaaagaaaacagaacacgattgtgatactagggatttaattaatgctagg 66  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  441834 gttgaaagaaaacagaacacgattgtgatactaggggtttaattaatgctagg 441886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University