View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10180_low_13 (Length: 229)

Name: NF10180_low_13
Description: NF10180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10180_low_13
NF10180_low_13
[»] chr5 (1 HSPs)
chr5 (1-229)||(40284351-40284579)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 40284579 - 40284351
Alignment:
Q  1 gaatgaaagatacttgattaaattgattcaatgaatgaaaaatacaaagagttaaacttatatacaatagcgaagcaaatgtatttgctaacaaatccct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||    
T  40284579 gaatgaaagatacttgattaaattgattcaatgaatgaaaaatacaaagggttaaacttatgtacaatagtgaagcaaatgtatttgctaacaaatccct 40284480  T
Q  101 aactaattcagttaagaaactaacttcctaaccagaagtctaactaactcgtccgagtctcgaccgtgtaatagtatttaaaccaaaaacaatagacatt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||    
T  40284479 aactaattcagttaagaaactaacttcctaaccagaagtctaactaactcgtccgagtctcaaccgtgtaatagtatttaaaccaaaagcaatagacatt 40284380  T
Q  201 cttattgataacaatcatatggacaataa 229  Q
    |||||||||||||||||||||||||||||    
T  40284379 cttattgataacaatcatatggacaataa 40284351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University