View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10179_high_42 (Length: 226)

Name: NF10179_high_42
Description: NF10179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10179_high_42
NF10179_high_42
[»] chr1 (2 HSPs)
chr1 (34-220)||(49553086-49553270)
chr1 (116-195)||(49538498-49538578)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 34 - 220
Target Start/End: Original strand, 49553086 - 49553270
Alignment:
Q  34 tcattgtaaatacatgaaactcaagcattgactacgactgtgctcttttaaacaggacattatattttcccaagcagaacacattctagattgtgcatga 133  Q
    |||||||||||||||||||||||||||||||||||||| |||||  |||||| |||||||||||| ||||||||||||||||||||||||||||||||||    
T  49553086 tcattgtaaatacatgaaactcaagcattgactacgaccgtgct--tttaaataggacattatatcttcccaagcagaacacattctagattgtgcatga 49553183  T
Q  134 aaacatcgatgaagagatagagggggtccagaacaatgagagatgggcttatgtgaaggttacattggacaaaaatgttcttctcac 220  Q
    |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||   |||| |||||||||||||||||    
T  49553184 aaacttcgatgaagagatagagggggtccagaacaatgagagatggggttatgtgaaggttaacatggagaaaaatgttcttctcac 49553270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 116 - 195
Target Start/End: Original strand, 49538498 - 49538578
Alignment:
Q  116 attctagat-tgtgcatgaaaacatcgatgaagagatagagggggtccagaacaatgagagatgggcttatgtgaaggtta 195  Q
    ||||||||| ||| ||||||||| | ||||||||||||||||| || |||| |||||||||||||||||||||||||||||    
T  49538498 attctagatctgtccatgaaaactttgatgaagagatagagggagtacagagcaatgagagatgggcttatgtgaaggtta 49538578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University