View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10176_low_41 (Length: 230)

Name: NF10176_low_41
Description: NF10176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10176_low_41
NF10176_low_41
[»] chr5 (1 HSPs)
chr5 (17-217)||(2347706-2347906)


Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 2347906 - 2347706
Alignment:
Q  17 atttggtatgcacctgaggttttaactgagctagaacaaatgaaaaatgcttttacctcttgtaagtactcagagaaagccgatgcatatagctttggta 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2347906 atttggtatgcacctgaggttttaactgagctagaacaaatgaaaaatgcttttacctcttgtaagtactcagagaaagccgatgcatatagctttggta 2347807  T
Q  117 tgatatgttttgagttgttgacagggaaaattccttttgaggacaatcatcttcaagggattagaaccaaccaaaatatcaaagcaggagagagaccttt 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2347806 tgatatgttttgagttgttgacagggaaaattccttttgaggacaatcatcttcaagggattagaaccaaccaaaatatcaaagcaggagagagaccttt 2347707  T
Q  217 g 217  Q
    |    
T  2347706 g 2347706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University