View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10174_low_83 (Length: 231)

Name: NF10174_low_83
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10174_low_83
NF10174_low_83
[»] chr1 (1 HSPs)
chr1 (35-213)||(2907743-2907921)


Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 35 - 213
Target Start/End: Original strand, 2907743 - 2907921
Alignment:
Q  35 ttattgatgtgtgtaagtacaaaatatccttttgataaatttaaatggattaattactatttagggttatacttaaaacttaaaagaaaaggaggtcaag 134  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  2907743 ttattgatgtgtgtaagtacaaaatatccttttgataaatttaaatggattaattactatttaggggtatacttaaaacttaaaagaaaaggaggtcaag 2907842  T
Q  135 atgttcatctcattcccctctctcctgggaatgagattgagatgtaaactctttttggtggaatctagcagtattatat 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  2907843 atgttcatctcattcccctctctcctgggaatgagattgagatgtaaactctttttggtggaatctagcagtgttatat 2907921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University