View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10174_low_30 (Length: 336)

Name: NF10174_low_30
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10174_low_30
NF10174_low_30
[»] chr8 (1 HSPs)
chr8 (5-312)||(40658907-40659214)


Alignment Details
Target: chr8 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 5 - 312
Target Start/End: Complemental strand, 40659214 - 40658907
Alignment:
Q  5 agaggagaagcatagggcaggctcaacttgggtggtgttttattcccgcttcagatatcggccttcttacacctggctcagttcggtacctgagttaccg 104  Q
    |||| |||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40659214 agagaagaatcatggggcaggctcaacttgggtggtgttttattccggcttcagatatcggccttcttacacctggctcagttcggtacctgagttaccg 40659115  T
Q  105 gctacgaggtaaagacggttccaggggacatgccataatcaacatctccgtcagattggagataacgacgttgatgtcatcgaacatggacacatgtcac 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  40659114 gctacgaggtaaagacggttccaggggacatgccataatcaacatctccgtcagattggagataacgacattgatgtcatcgaacatggacacatgtcac 40659015  T
Q  205 actgtcattgggatacctgtgacaacctttcgaggaacttaattaccatggttgaaagtggtttagcaggggtcagtgtcatcccgaattggatttcctg 304  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40659014 actgtcattgggatacctgtgacaacctttcgaggaacttaattaccatggttgaaagtggtttagcaggggtcagtgtcatcccgaattggatttcctg 40658915  T
Q  305 atgttaca 312  Q
    ||||||||    
T  40658914 atgttaca 40658907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University