View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10174_high_39 (Length: 220)

Name: NF10174_high_39
Description: NF10174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10174_high_39
NF10174_high_39
[»] chr8 (1 HSPs)
chr8 (1-220)||(34049280-34049497)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 34049280 - 34049497
Alignment:
Q  1 ctatgaatgcattctttaaaccttttactataataatttttatgaattatcttatttgtaataatatcatgtaaaatttaagattcnnnnnnnnnnnnaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||            ||    
T  34049280 ctatgaatgcattctttaaaccttttactataataatttttatgaattatcttatttgtaataatatcatgtaaaattta-gattctttttcgtttttaa 34049378  T
Q  101 tggaaaagaagaagatatccaatcaaattaattcattttggtgttttgaaaaattggccagatatacaaattccagttaacacagctctcagaccatgtg 200  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  34049379 tggaaaagaagaagatatccaatcaaataaattcattttggtgttttgaaaa-ttggccagatatacaaattccagttaacacagctctcagaccatgtg 34049477  T
Q  201 ccagaatctaatgtgagaaa 220  Q
    ||||||||||||||||||||    
T  34049478 ccagaatctaatgtgagaaa 34049497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University