View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1016_low_12 (Length: 248)

Name: NF1016_low_12
Description: NF1016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1016_low_12
NF1016_low_12
[»] chr1 (2 HSPs)
chr1 (147-248)||(51866591-51866692)
chr1 (29-70)||(51866806-51866847)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 147 - 248
Target Start/End: Complemental strand, 51866692 - 51866591
Alignment:
Q  147 gattgagtgaataatcaaaagagataaggagatgttagttttaacttttaattcaattttgataagttttaattcaagnnnnnnnggatcaaaacatgtt 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||       |||||||||||||||    
T  51866692 gattgagtgaataatcaaaagagataaggagatgttagttttaacttttaattcaagtttgataagttttaattcaagtttgtttggatcaaaacatgtt 51866593  T
Q  247 ta 248  Q
    ||    
T  51866592 ta 51866591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 70
Target Start/End: Complemental strand, 51866847 - 51866806
Alignment:
Q  29 agagtggacattcatttcaatgtcttttggtctgatttaccc 70  Q
    ||||||||||||||||||||||||||||||||  ||||||||    
T  51866847 agagtggacattcatttcaatgtcttttggtcatatttaccc 51866806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University