View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10163A_low_209 (Length: 221)

Name: NF10163A_low_209
Description: NF10163A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10163A_low_209
NF10163A_low_209
[»] chr4 (1 HSPs)
chr4 (83-198)||(3445973-3446088)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 83 - 198
Target Start/End: Original strand, 3445973 - 3446088
Alignment:
Q  83 tgatcacttgtgattatgacattaaaactgtgtctagccagcaaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacataatt 182  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  3445973 tgatcacttgtgattatgacattaaaactgtgtctagccagcgaagaatatctatagtttcccatgatgtcaaatcaatttgatgcttcaaaacatattt 3446072  T
Q  183 tgttcacccacctacc 198  Q
    ||||||||||||||||    
T  3446073 tgttcacccacctacc 3446088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University